Identification and Biochemical Characterization of a Novel Ryanodine Receptor Gene Mutation Associated with Malignant Hyperthermia

Blood and tissue samples were obtained after informed consent from all individuals involved in each aspect of this study or from relatives of deceased individuals. Ethical approval was obtained from the Manawatu-Whanganui (Palmerston North, New Zealand) and Massey University (Palmerston North, New Zealand) human ethics committees.

A 15-yr-old girl (fig. 1, V:16) underwent a cortical mastoidectomy in 1980 after a diagnosis of bacterial meningitis secondary to a suppurating ear infection treated with antibiotics. She subsequently had two anesthetics, using succinylcholine and halothane, over a 2-week period lasting 20 and 40 min for suction clearance and further review, respectively. Apart from a brief episode of bigeminal rhythm in the second procedure, which responded rapidly to 50 mg lignocaine intravenously, there were no problems. Anesthesia for the cortical mastoidectomy was induced with 40 mg alfaxalone, intubation facilitated with 80 mg alcuronium, and anesthesia maintained with nitrous oxide, oxygen, and halothane. The surgery was performed in semidarkness, with light provided only by the microscope. Monitoring consisted of manual palpation of the radial pulse. Darkness in the blood of the skin flaps was the first abnormality, noted after approximately 2.5 h; nitrous oxide was discontinued, and oxygen flow was increased to 6 l/min. The procedure was completed 15 min later. After removing the drapes, the patient appeared stiff, with pupils dilated and no respiratory effort, and twitching of the face muscles was apparent. Cardiac arrest occurred after a rapid deterioration. Resuscitation was unsuccessful. Core temperature of greater than 40°C was noted postmortem. Autopsy findings showed no intracranial or cardiac pathology. Subsequent questioning of the family indicated that a cousin had died 4 yr previously (case 2) with a presumptive diagnosis of MH.

An 11-yr-old girl (fig. 1, IV:6) underwent appendicectomy in May 1976. She received 200 mg thiopentone and 50 mg succinylcholine, she was intubated, and anesthesia was maintained with halothane. Within 10 min of induction, her pulse rate increased from 94 to 155 beats/min and remained at about this rate. Preoperatively, the temperature was recorded at 37.5°C but was not measured intraoperatively. The procedure took 35 min, and the patient arrived in recovery tachypneic with rigid limbs. She woke 10 min later, reporting stiffness and painful feet and legs. A succinylcholine reaction was considered to be the cause. She was noted to be mildly cyanosed, with a pulse rate of 152 beats/min, blood pressure of 185/100 mmHg, and grunting respiration. She arrested in ventricular fibrillation 15 min later and was defibrillated twice unsuccessfully. Postmortem examination showed no significant findings.

In vitro  contracture testing (IVCT) of muscle biopsies was performed according to the European Malignant Hyperthermia Group (Leeds, United Kingdom) protocol.#

Total RNA was extracted from 30–100 mg frozen skeletal muscle tissue using Trizol RNA extraction reagent according to the manufacturer's instructions (Invitrogen Life Technologies, Carlsbad, CA). Genomic DNA was isolated from leukocytes using the Wizard DNA extraction kit according to manufacturer's instructions (Promega Corporation, Madison, WI). Paraffin-embedded autopsy tissue samples were obtained from the two individuals with suspected MH (cases 1 and 2). DNA was prepared from deparaffinized tissue with prolonged treatment with proteinase K followed by phenol–chloroform extraction.19 

First strand synthesis was performed using the Superscript reverse transcriptase preamplification system (Invitrogen Life Technologies) with 4 μg total RNA and either 50 ng random hexamers or 500 ng oligo (dT) in a 20-μl volume. Hot-start polymerase chain reaction was performed using 1 μl of a 20-fold dilution of the first strand complementary DNA reaction in 50-μl reactions with 0.32 μm of each primer, 0.3 mm dNTPs, 1.5 mm MgCl², and 1.5 U Taq  polymerase (Invitrogen Life Technologies). Exon 100 of the RYR1  gene was amplified in one 208–base pair (bp) fragment using forward and reverse primers ACCTGGGCTGGTATATGGTG/TTATCCCTTCACCACCCACT, respectively. Sequencing was performed from a CCCTCTTGGGACACTACAACA primer using an ABI 377 with Big-Dye terminator chemistry (Applied Biosystems, Foster City, CA). The three mutational hot spots for MH/CCD were amplified and sequenced as previously described.20 

Exon 100 of RYR1  was amplified from genomic DNA and screened for the presence of the C14497T mutation by single-stranded conformation polymorphism analysis as previously described.21 

A diagnostic test for the C14497T mutation was developed using hybridization probes and real-time polymerase chain reaction using a Light Cycler (Roche Applied Science, Mannheim, Germany)22,23as follows. The allele-specific probe (CACCCACAATGGGAAACAGC) was labeled with Cy5.5, and the anchor probe (GCGCACCATCCTGTCCTC) was labeled with fluorescein. The sequences of the flanking primers were 5′-CACAGTCCTTCCTGTACC-3′ (forward) and 5′-GCCCTTATCCCTTCACC-3′ (reverse). The oligonucleotide primers and probes were designed using Light Cycler Primer Design software (Roche Applied Science). The following thermocycling protocol with the Light Cycler Hybridization probe kit (Roche Applied Science) was used for amplification: denaturation at 95°C for 120 s, followed by 55 cycles of 95°C for 0 s, 55°C for 10 s, and 72°C for 12 s, each with a temperature transition rate of 20°C/s and data acquisition at the annealing step. Primers were used at 0.5 μm, and probes at 0.2 μm, and MgCl²at 4 mm. Melting curve analysis was as follows: 95°C for 0 s and 45°C for 30 s, each with a temperature transition rate of 20°C/s followed by 75°C for 0 s at a temperature transition rate of 0.2°C/s with continuous data acquisition. For each step in the protocol, the fluorescence display was F3/1.

Haplotype analysis was performed using the D19S22024,25and D19S4726chromosome 19q microsatellite repeat markers that flank the RYR1  locus and three intragenic restriction fragment length polymorphism markers,27Ile1151 (Taq  I), Asp2729 (Fok  I), and Ser2862 (Cfo  I), as described previously.20Allele frequencies were as published.24–26 

Peripheral mononuclear cells were isolated by Ficoll-Hypaque (Amersham Biosciences, Amersham, United Kingdom) density gradient centrifugation, from whole blood. The isolated mononuclear cells were then transformed with Epstein-Barr virus.28Cells were grown in OptiMem medium (Invitrogen Life Technologies) supplemented with 2% fetal calf serum (Invitrogen Life Technologies), 2 mm l-glutamine (Invitrogen Life Technologies), and 100 U penicillin and streptomycin (Invitrogen Life Technologies), at 37°C, 5% CO².

Total microsomes were isolated from HEK293 cells, rat skeletal muscle, and Epstein-Barr virus–transformed B lymphocytes.28 RYR1  expression was analyzed using 6% SDS-PAGE and Western blotting. Immunostaining of proteins was performed using the ryanodine receptor–specific monoclonal antibody, 34C (Sigma, St. Louis, MO) and peroxidase-conjugated antimouse immunoglobulin G (Sigma) as secondary antibody followed by chemiluminescent detection (Roche Applied Science).

⁴⁵Ca²⁺uptake assays were performed in Hanks balanced salt solution (HBSS) containing 140 mm NaCl, 1 mm MgCl², 2 mm CaCl², and 10 mm HEPES (pH 7.4) as described previously.29Briefly, approximately 1 × 10⁷cells/ml were incubated with 5–10 μCi ⁴⁵CaCl²(Amersham Biosciences) at 37°C for 60 min in HBSS buffer, into which 0.5 mm Na–adenosine triphosphate, 5 mm K²C²O⁴, and 100 μg/ml heparin were added. Aliquots of 200 μl containing 0.8 × 10⁶cells were removed from the incubation medium at appropriate time intervals and washed four times with HBSS buffer. The final wash was performed in calcium-free HBSS buffer containing 2 mm EGTA. Cell pellets were either resuspended and lysed in 200 μl Triton, 0.1%, or resuspended in 200 μl calcium-depleted HBSS buffer and incubated with 400–800 nm thapsigargin to release incorporated ⁴⁵Ca²⁺. Radioactivity of the loaded/released ⁴⁵Ca²⁺was determined by liquid scintillation counting.

⁴⁵Ca²⁺release assays were performed using 4-Cm  C, after lymphocytes had been actively loaded for 1 h, with radioactive ⁴⁵Ca²⁺. Cells were washed as above. Supernatant (200 μl) from the final wash was reserved for scintillation counting as prestimulated released ⁴⁵Ca²⁺. Cell pellets were resuspended in 1 ml calcium-depleted HBSS buffer, and 200-μl aliquots of approximately 0.8 × 10⁶viable cells were transferred to separate microcentrifuge tubes and incubated with increasing concentrations of 4-Cm  C. Each sample was briefly centrifuged, and the resulting supernatant was collected and radioactivity determined by liquid scintillation counting. Counts per minute obtained for prestimulation were subtracted from those obtained after stimulation of cells with 4-Cm  C. The concentration of 4-Cm  C causing half-maximal release (EC⁵⁰) of ⁴⁵Ca²⁺was determined by curve fitting. Parallel experiments were performed where thapsigargin14was used to establish a reference standard for complete release of ⁴⁵Ca²⁺from endoplasmic reticulum stores. A time-dependence study of 4-Cm  C–stimulated calcium release was also performed29,30to compare the amount and the rate of ⁴⁵Ca²⁺release from B lymphocytes of both MHS and MH-negative (MHN) individuals over a period of 20 min. Except where indicated, all manipulations including loading and release assays were performed at 37°C and washes in ice-cold HBSS buffers.

Statistical analysis was performed using a paired t  test and one-way analysis of variance (repeated measures). Analysis was performed using Analyse-it**(Microsoft, Redmond, WA) software for general and clinical laboratory statistics Excel version 1.73.

A T4826I mutation had previously been identified in exon 100 of RYR1  in a large Maori MHS pedigree.21As part of screening for the presence of this mutation in other MHS families, a 208-bp fragment encompassing exon 100 was amplified from genomic DNA of MHS individuals from other families and subjected to single-stranded conformation polymorphism analysis. An additional variant was identified, in a relative of case 1 (fig. 1, IV:17), by the appearance of an additional single-stranded DNA species that migrated slightly slower than the band associated with the T4826I mutation (fig. 2A, lane 2). DNA sequence analysis of the 208-bp polymerase chain reaction product revealed a novel C14997T transition that substituted tyrosine for histidine 4833 (fig. 2B). The three MH/CCD mutation regions were then sequenced, and no additional mutations were identified. Two hundred twenty chromosomes from unrelated (no family history of MH) control subjects of both Maori and Caucasian origin were analyzed by single-stranded conformation polymorphism for the presence of the C14997T polymorphism. The mutation was not detected in any of these families. H4833 is conserved across 14 ryanodine receptor sequences from human to Drosophila melanogaster .

Relatives of both individuals have had IVCT using the European Malignant Hyperthermia Group Protocol. Four had MHS test results, 3 had MH-equivocal results, and 12 had MHN results and are indicated in figures 1 and 3.

A diagnostic test from genomic DNA was developed to facilitate analysis of additional family members. The heterozygote was clearly distinguished from the homozygote with melting temperatures of the wild-type and mutant alleles of 64°C and 55°C, respectively (data not shown). The RYR1  C14497T mutation was identified in DNA extracted from postmortem specimens of both case studies. The same mutation was identified in extended family members (fig. 1) as well as in a second family previously suspected to be susceptible to MH (fig. 3). There was complete concordance between the presence of the mutation and MHS in both families. These data suggest that the H4833Y mutation is causative of MH in the two families. The mutation was not detected in any of the MH-equivocal patients. We have yet to identify an MH-equivocal patient in any New Zealand family with an RYR1  mutation.

Haplotype analysis was performed on selected samples to examine the possibility that the two families had a common ancestor. Microsatellite markers flanking the RYR1  locus and three intragenic restriction fragment length polymorphism markers were used to analyze the chromosome 19q13.1 genotype in both families.24–26This analysis revealed a common haplotype (3-2-2-1-5) that segregated with MHS in each family (figs. 1 and 3). Allele 3 for the D19S220 dinucleotide repeat is one of the least common reported in the Caucasian population.24,25Allele 5 for the D19S47 dinucleotide repeat has an intermediate frequency in an undefined population.26These results suggest that both families have inherited the H4833Y mutation from a common ancestor.

The expression of RYR1  in immortalized lymphocytes was investigated by immunoblotting analysis on subcellular membrane fractions. A distinct immunoreactive band of approximately 565 kd representing the ryanodine receptor was identified in rat skeletal muscle (fig. 4, lane 2) as well as in B lymphocytes (lane 4) but not in HEK293 cells (lane 3), which do not express the gene for the ryanodine receptor. Although the 34C antibody does recognize all three RyR isoforms, it has a lower affinity for RyR2 and RyR3, and RyR1 has been shown to be the predominant isoform expressed by B lymphocytes.16 

Lymphocytes were loaded with ⁴⁵Ca²⁺and total Ca²⁺stores estimated after lysis with Triton X-100. The total ⁴⁵Ca²⁺incorporated into the cells and released by lysis with 0.1% Triton (results not shown) was only 2% greater than that released by 800 nm thapsigargin. Therefore, the amount released by 800 nm thapsigargin (considered to be approximately 100%) was used as a reference for ⁴⁵Ca²⁺release.14,31Cells from MHS (fig. 1, IV:2 and V:13, and fig. 3, II:4) and MHN (fig. 1, V:10 and V:15, and fig. 3, III:4) patients were treated with 400–800 mm thapsigargin, which specifically blocks the sarco(endo) plasmic reticulum Ca²⁺–adenosine triphosphatase,32,33to stimulate Ca²⁺release from stores. No significant differences were found between MHS and MHN lymphocytes (data not shown). Therefore, the H4833Y mutation does not affect the thapsigargin-sensitive Ca²⁺pool.

Drug-induced ⁴⁵Ca²⁺release was initiated in a concentration-dependent manner with 4-Cm  C.18Cells were stimulated with increasing concentrations of 4-Cm  C up to 1,000 μm, and the amount of ⁴⁵Ca²⁺released was calculated as a percentage relative to that which could be released by 800 nm thapsigargin. The amount of ⁴⁵Ca²⁺released from MHS cells was significantly greater than that from MHN cells at all concentrations of 4-Cm  C used (fig. 5). The EC⁵⁰of ⁴⁵Ca²⁺was lower for MHS cells (370 μm) than for MHN cells (670 μm), indicating a higher sensitivity to 4-Cm  C (fig. 5).

A novel RYR1  C14997T mutation has been identified from postmortem tissue of two individuals who had fatal MH episodes, as well as from genomic DNA of relatives. MH susceptibility was confirmed by positive IVCT results of relatives. In addition, we have shown unequivocal evidence of cosegregation of the C14997T mutation with clinical diagnosis of MHS in two patients with fulminant MH episodes and in four patients diagnosed as MHS by IVCT, and absence of this mutation in 15 relatives diagnosed as MHN or MH-equivocal by IVCT. Taken together, these observations suggest a causative role in MH for the C14997T mutation.

We have shown that H4833Y is a potential candidate for MHS rather than a rare polymorphic codon by performing biochemical assays with 4-Cm  C in immortalized B lymphocytes from MHS individuals carrying the mutation and MHN individuals from two families. The amount of actively loaded ⁴⁵Ca²⁺released by 4-Cm  C from MHS cells was significantly greater than that released from MHN cells. Compared with MHN cells, 1.8-fold lower concentrations of 4-Cm  C were required to activate the release of 50% of the releasable ⁴⁵Ca²⁺from lymphocytes of MHS individuals harboring the skeletal muscle ryanodine receptor H4833Y mutation. This suggests that the increased ⁴⁵Ca²⁺response by B cells of MHS individuals to lower concentrations of 4-Cm  C is associated with this RYR1  mutation. These results are similar to those of previous studies on other RYR1  mutations that showed a 1.8- to 2.0-fold decrease in EC⁵⁰for 4-Cm  C–induced Ca²⁺release from MHS compared with MHN cells.14,34–36The H4833Y mutation does not seem to affect the thapsigargin-sensitive calcium pool, indicating that it is likely to be an MH-specific mutation rather than causative of CCD, because many CCD mutations in this region of the gene cause the channel to be leaky.1 

We have developed a robust DNA-based diagnostic test for MH susceptibility in these two families so that other family members can be tested without the need for the IVCT. According to the European Malignant Hyperthermia Group guidelines,37a negative result for the DNA test does not necessarily confer nonsusceptibility; however, a negative mutation analysis coupled with a negative B-lymphocyte test should be sufficient to make an MHN diagnosis. Of course, this does not rule out spontaneous mutations in the dihydropyridine receptor or other genes yet to be identified with MH. Some caution must also be exercised with an MHN diagnosis by DNA analysis, in families where discordance has been reported.21,38–40 

This method of identifying MH susceptibility from postmortem tissue has yielded positive results in two other individuals. Both were sudden deaths unrelated to anesthesia, and both were from a family with a known RYR1  mutation. DNA was extracted from archival postmortem tissue from a female child who died at 9 months of age in 1969 and from a 2-yr-old girl several months after death following a 3-day viral illness. In both of these cases, DNA was extracted from postmortem tissue, and the familial mutation was demonstrated in both specimens.20 

Patients may present for anesthesia with a family history of a fatality associated with anesthesia in a family member, which has not been previously investigated. In some cases, it may be possible to investigate the index case by postmortem analysis.21Such a practice will assist in confirming MH susceptibility in families where little historic clinical information is available.

In conclusion, we suggest that the H4833Y substitution is causative of MH because Y4833 is associated with the MHS phenotype in two families and is absent in control individuals, H4833 is conserved across species, and it is located in an MH/CCD hot spot region of the RYR1  gene. Moreover, functional assays using immortalized B lymphocytes from patients harboring this mutation showed a significant increase in the amount of ⁴⁵Ca²⁺released compared with MHN cells.