Nerve Growth Factor Expression after Plantar Incision in the Rat

FOR most patients’ postoperative pain control, opioids are used. These drugs by themselves show incomplete analgesic effects. Local anesthetic injections and perineural infusions can also be used; however, these are for a minority of patients. It will be helpful for developing ideal analgesic drugs and novel therapies if we can further reveal the underlying mechanisms of incisional pain and its mediators. A number of mediators including nerve growth factor (NGF),1^,2 prostaglandins,3 lactate,4 and acid5 likely contribute to nociceptor sensitization, hyperalgesia, and clinical pain after incision.

Among these factors, close attention has been paid to NGF, which is known as a neurotrophic factor necessary for promotion and survival of nociceptors and the sympathetic nervous system during development.6 In the adult, NGF is considered an important intermediary for the sensitization of nociceptors and induction of inflammation.7 Furthermore, administration of exogenous NGF has been shown to produce hyperalgesia in rats8 and humans,9^,10 and neutralization of NGF by trkA–immunoglobulin G (IgG) fusion molecule prevents the sensitization of nociceptors in some pain models.11^,12 

An incision produces an acute increase in NGF levels in skin and we have shown the neutralization of endogenous NGF produces specific antihyperalgesic effects without any acute influence on normal nociceptive responses.1^,2 The increase in NGF occurs at times that are coincident with its role in pain-related behaviors. In the current study, we examined NGF expression in skin after plantar incision by using quantitative reverse-transcriptase polymerase chain reaction (PCR), Western blot, and immunohistochemistry. We determined which form of NGF is present in normal and incised skin, the changes in NGF protein and messenger RNA (mRNA) at different times after incision, and the distribution and location of NGF after incision.

This study was approved by the institutional animal care and use committee at the University of Iowa (Iowa City, Iowa). The rat hind paw plantar incision model was performed in male Sprague-Dawley adult rats weighing 225–300 g as described.13 During anesthesia of 1.5–2.0% halothane, a 1-cm longitudinal incision was made 0.5 cm from the end of heel in the plantar aspect of right hind paw. The underlying flexor muscle was divided, and then the skin was sutured with 5.0 nylon. Antibiotic ointment was applied to the incision immediately after surgery. Sutures were removed on postoperative day (POD) 2. For some rats, a 0.5-cm transverse incision was made 1.0 cm from the end of heel in the right hind paw to examine distal versus proximal NGF expression.

Total RNA from incised rat skin tissue samples was prepared according to manufacturer’s instructions using the RNeasy micro kit (cat. No. 74103; Qiagen, Valencia, CA). Some skin samples from sham-incised rat were used as control. The RNA was quantified using Ribogreen reagent (Molecular Probes, Eugene, OR). Two-step reverse-transcriptase PCR was performed on a 7000 Sequence Detection System (Applied Biosystems, Foster City, CA) by using the TaqMan Gold Reverse Transcriptase PCR kit (Applied Biosystems). The RNA was reverse transcribed using random hexamers, and the complementary DNA was amplified using a primer/probe set specific for NGF (RatNGF-fwd: TGACTCCAAGCACTGGAACTCAT, complementary to 693–715 nucleotides in the rat NGF mRNA; RatNGF-rev: GTTTGTCGTCTGTTGTCAACGC, complementary to 947–926 nucleotides in the rat NGF mRNA; RatNGF-Tamra: TGCACCACGACTCACACCTTTGTCA, complementary to 718–742 nucleotides in the rat NGF mRNA). The resulting PCR product was 309 base pairs in length. Thermal cycling was initiated with an initial incubation at 95°C for 10 min. After that, 40 cycles of PCR were performed; each PCR cycle consisted of heating at 95°C for 15 s for melting and at 60°C for 1 min for annealing and extension. The samples were analyzed in triplicate from the reverse-transcription step and normalized to the internal control, a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase. No template samples were used as controls. PCR data were analyzed by ΔΔCt method described in detail by Livak and Schmittgen.14 

Rats were anesthetized with sodium pentobarbital (150 mg/kg) after sham surgery, or 4 h, day 1, 2, or 7 or 2 weeks after plantar incision. Plantar skin samples were collected and then homogenized and lysed on ice in radioimmunoprecipitation assay buffer containing protease inhibitors. The supernatant was collected by centrifugation, and the protein concentration was quantified by spectrophotometry using the Lowry method.

Twenty micrograms of protein in 20 μl of volume from each sample was electrophoresed on 12% sodium dodecyl sulfate–polyacrylamide gels and then transferred to polyvinylidene difluoride membranes (Bio-Rad Lab, Hercules, CA). The membranes were incubated in rabbit anti-NGF polyclonal antibody15,^–17 (1:1,000, cat. No. sc-548; Santa Cruz Biotechnology Inc., Santa Cruz, CA) at 4°C overnight, followed by incubation in peroxidase-conjugated donkey anti-rabbit IgG secondary antibody (1:10,000; Jackson ImmunoRes, West Grove, PA) for 4 h. Membranes were then developed with SuperSignal West Femto Maximum Sensitivity Substrate (Pierce Biotechnology Inc., Rockford, IL) and scanned by Kodak Image Station 440 scanner (Eastman Kodak Company, Rochester, NY). After incubating the membranes in stripping buffer at 50°C for 30 min, the membranes were probed for actin as a loading control. Ten nanograms of rat NGF (N2513; Sigma, St. Louis, MO) was also used as a control. The blocking hapten peptide (cat. No. sc-548 P; Santa Cruz Biotechnology Inc.), containing the antigen (100 μg/0.5 ml) used to raise the antibody to rat, mouse, and human NGF, was used to examine the specificity of the anti-NGF antibody. This peptide is within the amino acids 100–150 of human NGF (personal communication, Santa Cruz Biotechnology, May 12, 2006). The intensity of the NGF immunoreactive bands was quantified and normalized with actin bands by Image J software (National Institutes of Health, Bethesda, MD).

Briefly, rats were anesthetized with sodium pentobarbital (150 mg/kg) and transcardiacally perfused with 0.1 m phosphate-buffered saline, followed by 4% paraformaldehyde. The glabrous plantar skin samples were removed from sham and incised hind paws and postfixed in the same fixative for 4 h. After washing in gradually increasing concentrations of sucrose, samples were rapidly frozen in 2-methylbutane chilled at −80°C. Consecutive sections (10 μm) were prepared and frozen at −80°C until use. NGF expression was visualized by NGF immunohistochemistry using the ABC method. The following antibodies were used: rabbit anti-NGF antibody (1:2,000, cat. No. sc-548; Santa Cruz Biotechnology Inc.) and biotinylated anti-rabbit IgG (1:500; Vector Laboratories, Burlingame, CA). In some cases, consecutive sections underwent NGF immunohistochemistry or hematoxylin and eosin staining to examine the structures with NGF-positive staining. For controls, some sections were processed after preabsorption of the anti-NGF antibody with the blocking peptide (4 pg/μl). Other sections were processed without the primary or the secondary antibody as controls.

Because perineural structures seemed to be immunoreactive in incised skin, we examined the cells that were immunoreactive for NGF protein. Double-labeling confocal microscopy and immunofluorescent staining were performed for NGF and S100 or NGF and protein gene product 9.5 (PGP 9.5). S100, a glial cell marker in central nervous system and a Schwann cell marker in the peripheral nervous system,18 was used to covisualize NGF and Schwann cells. NGF and PGP 9.5 (a panaxonal marker) double labeling were performed to examine the colocalization of NGF and nerve fibers. Endogenous peroxidase was inactivated by incubating the sections of skin from rats on POD 1 with 30% methanol containing 0.1% H₂O₂ (vol/vol) for 45 min. To block nonspecific reactions, sections were incubated in 0.1 m phosphate-buffered saline containing 1.5% bovine serum albumin, and 0.1% Tween-20 for 1 h. Sections were then processed for NGF and S100 double labeling by using rabbit anti-NGF polyclonal antibody and mouse anti-S100 monoclonal antibody (1:500, cat. No. MAB079-1; Chemicon, Temecula, CA) as the primary antibodies, followed by incubating in Cy3-conjugated goat anti-rabbit IgG (1:200; Jackson ImmunoRes) and Cy2-conjugated goat anti-mouse IgG (1:200; Jackson ImmunoRes). For NGF/PGP 9.5 labeling, the same antibodies were used as described above. Guinea pig anti–PGP 9.5 polyclonal antibody (1:100, cat. No. AB5898; Chemicon) and Cy2-conjugated donkey anti–guinea pig IgG (1:200; Jackson ImmunoRes) were used for axon labeling.

Sections were mounted by DPX and observed under Zeiss 510 confocal microscopy (Carl Zeiss MicroImaging, Inc., Thornwood, NY). Digital images were collected in the LSM 510 software (Carl Zeiss MicroImaging, Inc.). For controls, sections were stained without primary or secondary antibodies; in addition, some sections were processed with a single antibody, NGF, S100, or PGP 9.5.

Nerve growth factor–labeled and NGF/S100 or NGF/PGP 9.5 double-labeled objects within nerve bundles were counted manually using Adobe Photoshop CS software (Adobe Systems Inc., San Jose, CA). The percentage of double-labeled versus NGF immunoreactive objects was obtained. Three random sections from each of three incised rats were studied.

Data were expressed as mean ± SD. Differences between means were determined by one-way analysis of variance followed by Dunnett post hoc test for comparisons of incision versus sham. P < 0.05 was considered statistically significant.

Nerve growth factor mRNA increased 16.8 ± 4.4-fold (P < 0.05 vs. sham) at 2 h and 12.0 ± 5.3-fold (P < 0.05 vs. sham) at 4 h after incision compared with sham control skin (fig. 1). The level of NGF mRNA was not significantly increased after POD 1 and was similar to the contralateral nonincised hind paw.

Western blot analysis indicated that NGF immunoreactive protein was present in plantar hind paw skin. A representative blot is shown in figure 2A. A large-molecular-weight (MW) form of NGF protein was present in sham-operated skin and incised skin on POD 1 and POD 2. Blots from six rats are shown in figure 2A. The MW was approximately 75 kd. Our antibody detected mature rat NGF, MW approximately 16 kd, which was not present in any skin samples. Incision increased the intensity of expression of the high-MW NGF 4 h later (fig. 2B); the increase was sustained through POD 2 and returned to the basal, unincised level on POD 7. A summary quantifying the NGF immunoreactive bands for different times after incision is shown in figure 2C. NGF protein was increased 4.6 ± 2.9-fold (P < 0.05 vs. sham) at 4 h, 5.7 ± 3.4-fold (P < 0.01 vs. sham) on POD 1, and 3.7 ± 2.5-fold on POD 2 (n = 6 per group) compared with sham-operated skin.

The distribution of NGF in incised skin was also examined using Western blot. Samples were taken from two concentric areas surrounding the incision (fig. 3A). Area A was an elliptical region excised from the 1-mm area adjacent to the incision, whereas area B was 1 mm further outside area A. NGF protein increased 4.6 ± 2.4-fold (P < 0.05 vs. sham) on POD 2 in area A. There were no changes of NGF in area B on POD 2 (figs. 3B and C, n = 3 per group). Therefore, the entire increase in protein seemed to come from the area immediately surrounding the incision.

Sections of sham, incised and contralateral, unincised skin were collected 4 h after incision, POD 1, POD 2, POD 7, and 2 weeks after incision for NGF immunohistochemistry. There was no NGF immunoreactivity detected in sham-operated, control skin (fig. 4A). NGF immunoreactivity (arrows) was found adjacent to the incision (dashed line) on POD 1 (fig. 4B). A higher magnification of the rectangular area marked in figure 4B is shown in figure 4C. No NGF immunoreactivity was detected surrounding the incision on POD 7 (fig. 4D) or when the antibody was pretreated with the blocking peptide (data not shown).

There were no immunoreactive elements in deep, subcutaneous layers in unincised skin (fig. 5A), but NGF-positive staining could be observed in subcutaneous layers after plantar incision (fig. 5B). In this example, most of these NGF immunoreactive elements were localized within apparent nerve-like structures that were adjacent to an artery and vein. Consecutive sections processed for NGF immunohistochemistry and hematoxylin and eosin staining detected NGF-positive staining (fig. 5C, arrows) localized to nerve bundles (fig. 5D, arrows).

We hypothesized that Schwann cells or nerve fibers could be staining for NGF. To confirm the location of NGF in incisions, we identified NGF positive staining in incised tissue. Sham control tissue was also examined. Because control tissue did not stain for NGF, we evaluated PGP 9.5–positive and S100-positive regions. In large nerve bundles, there was no NGF-positive labeling (fig. 6A) in normal skin, and Schwann cells were S100 positive (figs. 6B and C, green) in normal skin. In contrast, NGF-positive staining could be found in nerve bundles from incised skin (fig. 6D, red), and some were colocalized with S100 (fig. 6E, green) and thus were Schwann cells (fig. 6F, arrows). From nine sections from three incised rats, 19 ± 11% of NGF-positive objects were colocalized in Schwann cells. Some NGF staining was present in other structures (fig. 6F, arrowheads).

Axon staining was examined next. In normal skin, there was no NGF-positive labeling (figs. 7A–C). In incised skin, nine sections from three incised rats showed that 63 ± 11% of NGF-positive objects (fig. 7D, red) were colocalized with PGP 9.5 (fig. 7E, green) and thus were nerve fibers (fig. 7F, arrows).

We noted that NGF seemed to be present distal to cut axons in incised tissue. After a transverse plantar incision (fig. 8A), NGF-positive staining (arrows) was largely found distal (fig. 8B) but not proximal to the incision (fig. 8C). However, Western blot showed equal (fig. 8D) NGF protein distal (3.8 ± 2.5-fold) and proximal (3.7 ± 2.4-fold) to the transverse incision (fig. 8E, n = 6 per group).

In this study, we demonstrate that NGF mRNA increases from 2 to 4 h after incision. We found that the high-MW form of NGF protein is normally present in rat skin. This same form increases from 4 h after incision, is maintained for several days, and is normal by POD 7. The increase in large-MW form of NGF is in the area immediately surrounding the incision. In normal skin, immunohistochemistry does not identify NGF-positive structures. After incision, NGF immunoreactive structures are identified; most are adjacent to the incision. Immunoreactive NGF is present in axons; some Schwann cells are labeled. The increase in NGF detected by Western blot and immunohistochemistry coincides with its role in guarding pain and heat hyperalgesia after incision.1^,2 These findings may be helpful for understanding the function of increased NGF in incised skin and the mechanisms whereby NGF contributes to postoperative pain.

A large-MW form of NGF, approximately a 75-kd species, was consistently detected in all skin samples. Because mature NGF is approximately 16 kd, this large-MW form is likely a glycosylated precursor, like preproNGF, or a dimer of a precursor form as described by others.15^,19 Our findings are supported by another study showing that a 75-kd form of NGF is present in ovine skin but the mature 16-kd NGF was absent.19 Bierl et al. demonstrated that “mature” forms of the lower-MW NGF proteins are rare in many tissues, large-MW NGF precursors are abundant in peripheral tissues, and each tissue exhibits a characteristic NGF expression pattern.15^,16 These precursory forms from which mature NGF is cleaved may also be biologically active and contribute to acute pain in this incision model.

Increased NGF mRNA was found in incised skin for 1 day only. NGF mRNA is increased for more than 15 days after major nerve injury.20 The short-lasting increase of NGF mRNA and protein after incision may account for the short duration of acute incisional pain, whereas the long-lasting increase in NGF mRNA after large nerve injury may contribute to a more persistent pain state. This difference in onset and duration of NGF mRNA production may explain some differences between the two pain states.

Nerve growth factor was present in the incised area; the greatest increase was immediately adjacent to the incision. The immunoreactivity was also adjacent to the incision. The innervation of the glabrous skin in the hind paw is largely from the tibial nerve which branches into the plantar nerves. These plantar nerves are large at the malleoli and send branches distal toward the digits. We made a transverse incision in the paw to cut the distal nerve fibers. Immunoreactivity was greatest distal to a transverse incision.

After major nerve injury, NGF is taken up by Schwann cells and axons.21 Intact axons transport the NGF proximally to the dorsal root ganglia, where transcription of a variety of proteins are affected.22 Cut axons and the Schwann cells surrounding cut axons take up NGF.23^,24 The cut axons do not retrogradely transport NGF, and it is concentrated there. Other studies demonstrate that Schwann cells produced both NGF and the NGF receptor, P75, in the sciatic nerve distal but not proximal to the transection.25^,26 Therefore, the distribution of immunoreactive NGF in incisions is likely uptake of NGF by Schwann cells and cut axons. Without axonal transport, NGF accumulates in sufficient quantities to be immunoreactive. It is possible that NGF is produced by Schwann cells as well.

Released NGF will be taken up by intact nociceptors and produce peripheral sensitization and hyperalgesia.27 NGF accumulates in injured axons and will contribute to regeneration.28 In addition, NGF can influence expression of a variety of factors in the dorsal root ganglia, some of which are transported to the central nervous system. Both peripheral and central sensitization may occur.29 This mechanism has been proposed for large nerve injury causing persistent neuropathic pain.27 

In summary, NGF mRNA increases for 1 day after plantar incision. A high-MW form of NGF is present and increased at the time NGF contributes to incision-induced pain behavior. NGF immunoreactivity is present in nerve bundles; both Schwann cells and axons are labeled. Immunoreactive NGF in axons is likely uptake into cut axons. This study suggests some common mechanisms for neuropathic and incisional pain.